90
|
Ribobio co
chip-pcr primers Chip Pcr Primers, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/chip-pcr primers/product/Ribobio co Average 90 stars, based on 1 article reviews
chip-pcr primers - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
primer for chip-pcr Primer For Chip Pcr, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer for chip-pcr/product/Biolegio bv Average 90 stars, based on 1 article reviews
primer for chip-pcr - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
AITBIOTECH Pte Ltd
chip qrt-pcr promoter primer sequences Chip Qrt Pcr Promoter Primer Sequences, supplied by AITBIOTECH Pte Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/chip qrt-pcr promoter primer sequences/product/AITBIOTECH Pte Ltd Average 90 stars, based on 1 article reviews
chip qrt-pcr promoter primer sequences - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
chip pcr primers Chip Pcr Primers, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/chip pcr primers/product/GenScript corporation Average 90 stars, based on 1 article reviews
chip pcr primers - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
primer for chip-pcr tnfa reverse gctttcagtgctcatggtgt Primer For Chip Pcr Tnfa Reverse Gctttcagtgctcatggtgt, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer for chip-pcr tnfa reverse gctttcagtgctcatggtgt/product/Biolegio bv Average 90 stars, based on 1 article reviews
primer for chip-pcr tnfa reverse gctttcagtgctcatggtgt - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
Midland Certified Reagent
pcr primers chromatin immunoprecipitation (chip) analysis Pcr Primers Chromatin Immunoprecipitation (Chip) Analysis, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcr primers chromatin immunoprecipitation (chip) analysis/product/Midland Certified Reagent Average 90 stars, based on 1 article reviews
pcr primers chromatin immunoprecipitation (chip) analysis - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
primer for chip-pcr tnfa forward caggcaggttctcttcctct Primer For Chip Pcr Tnfa Forward Caggcaggttctcttcctct, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer for chip-pcr tnfa forward caggcaggttctcttcctct/product/Biolegio bv Average 90 stars, based on 1 article reviews
primer for chip-pcr tnfa forward caggcaggttctcttcctct - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
primers for chromatin immunoprecipitation (chip) pcr Primers For Chromatin Immunoprecipitation (Chip) Pcr, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers for chromatin immunoprecipitation (chip) pcr/product/GenScript corporation Average 90 stars, based on 1 article reviews
primers for chromatin immunoprecipitation (chip) pcr - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
primer for chip-pcr il-6 forward agggagagccagaacacaga Primer For Chip Pcr Il 6 Forward Agggagagccagaacacaga, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer for chip-pcr il-6 forward agggagagccagaacacaga/product/Biolegio bv Average 90 stars, based on 1 article reviews
primer for chip-pcr il-6 forward agggagagccagaacacaga - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
primer for chip-pcr gapdh forward  Primer For Chip Pcr Gapdh Forward, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer for chip-pcr gapdh forward/product/Biolegio bv Average 90 stars, based on 1 article reviews
primer for chip-pcr gapdh forward - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
RainDance Technologies
primer library genomic dna template mix microfluidic chip off-chip pcr droplets break emulsion dna clean-up sequence Primer Library Genomic Dna Template Mix Microfluidic Chip Off Chip Pcr Droplets Break Emulsion Dna Clean Up Sequence, supplied by RainDance Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer library genomic dna template mix microfluidic chip off-chip pcr droplets break emulsion dna clean-up sequence/product/RainDance Technologies Average 90 stars, based on 1 article reviews
primer library genomic dna template mix microfluidic chip off-chip pcr droplets break emulsion dna clean-up sequence - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: iScience
Article Title: Peripheral blood mononuclear cell hyperresponsiveness in patients with premature myocardial infarction without traditional risk factors
doi: 10.1016/j.isci.2023.107183
Figure Lengend Snippet:
Article Snippet:
Techniques: Recombinant, Protease Inhibitor, SYBR Green Assay, Enzyme-linked Immunosorbent Assay, Purification, Magnetic Beads, Software, Flow Cytometry